İlker Öztop, Aysu Uygur, Alp Sipahigil halka açık
[search 0]

Download the App!

show episodes
Loading …
show series
Bilim Kazanı’nında ocağı kapatıp ortadan kaybolduğumuz son 1 sene boyunca diyar diyar gezdik, binbir serüven yaşadık, fantastik iblislerle boğuştuk, kalipsolarla sınandık ve nihayet eve geri döndük! Bu seyahatlerimizden birinde, Afrika’nın amansız Okavango yabanında üç aslan tarafından kapana kıstırılmışken ve hiç umudumuz kalmamışken sevgili Dokto…
Geçen hafta anons edilen kütleçekimsel dalga deneyleri, bilim dünyasında ve elbette sosyal medyada çılgınca bir sevinç dalgası yarattı. Peki bu kadar gülünecek ne vardı? LIGO deneyi sayesinde varlığı teorik olarak öngörülen kütleçekimsel dalgalar bilim tarihinde ilk defa tespit edildi. Bundan 1.5 milyar yıl önce biri 36 diğeri 29 güneş kütlesinde i…
Sadece biyolojik bilimler için değil, tüm bilim camiası için son zamanların en heyecan verici ve paradigmaları değiştiren buluşu, CRISPR-Cas9 genom mühendisliği teknolojisi oldu. CRISPR-Cas9, son yıllarda geliştirilen bir genetik müdahale teknolojisi. Bu yeni sistem sayesinde, canlıların genetik materyalini son derece hızlı, kolay, ve hata payını ç…
[scroll down for English description] 3 senedir Bilim Kazanı’na sayısız bilim insanını davet edip, akademik bilimi günlük hayat ile buluşturan ekibimiz, bu defa günlük hayatı akademideki bilimcilerimizin ayağına getiriyor! Oystir, doktora ya da doktora sonrası araştırma yapan akademisyenlere çalışma hayatına akademi dışında devam etmeleri için gere…
6 aylık ataletimizi attık, bilime kaldığımız yerden devam ediyoruz! Işığın gürültüsü nedir? Nasıl azaltılır? Süper atom ne işe yarar? Kuantum seviyesindeki problemlere kafa yorarak Türkiye’nin gürültülü politik gündeminden dışarıya ışınlanmak isterseniz, size elimizdeki en iyi parça olan Işığı Sıkıştıran Adam’ı veriyoruz. Cambridge Üniversitesi fiz…
”Eskiler alıyorum Alıp yıldız yapıyorum Musiki ruhun gıdasıdır Musikiye bayılıyorum..” Orhan Veli Kanık Bilim Kazanı’nda bu hafta ruhumuzun gıdası musikiyi masaya yatırıyoruz, inleyen nağmelerin ardındaki fiziksel ve biyolojik bilimi tartışıyoruz. Ses nedir? Nasıl oluşur? Nota nedir, peki musiki nasıl oluşur? Tamburun tellerinden çıkan basınçla bir…
Harvard Üniversitesi’nde Felsefe ve Psikoloji Bölümleri’nde Zihin-Beyin-Davranış Programı’nda akademik çalışmalarını yürüten Dr. Güven Güzeldere, Bilim Kazanı’nın 34. bölümünde hem Benedict Cumberbatch’e yapay zeka araştırmalarının manevi babası Alan Turing’in hayatını çarpıttığı için ayar vermeye, hem de bizim biyolojik aklımızı uçurup yerine yapa…
Yeni bölümümüzde çocuklarını aşılatmayan ebeveynlerin sıklıkla kullandığı argümanları kaz tüyüyle gıdıklıyoruz. Bilim Kazanı, Yalansavar‘dan Tıp Doktoru Işıl Arıcan’ı konuk aldığı 33. bölümünde aşı dosyasını ülkeler ve şirketlerüstü bagımsız kaynaklardan faydalanarak masaya yatırıyor, aşı karşıtlarının fikirlerini bir nebze gözden geçirmeleri için …
Muhterem Kepçeler, Muhteşem Kepçelerimiz, Türkçe orjinal içerikli popüler bilim cepyayıncılığı maceramızda 2014 yılını geride bırakırken, Bilim Kazanı olarak Science dergisinin bu senenin en çığır açıcı 10 bilimsel buluş listesini inceledik ve sadece 2014’e değil önümüzdeki yıllara da damgasını vuracağı aşikar 3 heyecan verici çığırı sizin için lim…
BU DEFA ÖYLE BİR BÖLÜM YAPTILAR Kİ….(Tıklayın) Bu bölüm omurgalılarda penisin kökenlerini inceliyoruz. Geçtiğimiz haftalarda Nature dergisinde yayınlanan ve dünya popüler bilim basınında zelzele yaratan makaleyi Aysu’nun bizzat araştırmanın yapıldığı laboratuvarda çalışması sayesinde en ince detaylarına, bilinmeyen yönlerine ve hocaların skandal em…
Sadık Bilim kepceleri, iflah olmaz Kazan tutkunları, Geçtiğimiz hafta yeni ufuklara yelken açmak üzere Bilim Kazanı’nın 94.9FM Açık Radyo’daki jubilesini yaptık. Ama podcastlere devam! Veda Hutbemizi kaçırmayın, bizi gene web sitemizden, Facebook‘tan, Twitter‘dan, RSS‘ten, iTunes‘dan eski usul takibe alın. Bu bölüm keyfimizin kâhyası olduk, önümüzd…
Cahille sohbeti kesin, global sağlık girişimlerini Bilim Kazanı’ndan ve seyyah doktor Aybike Onur’dan dinleyin. Son örneğinin ebola vakalarının ele alınması olduğu global sağlık girişimlerine yaklaşımınız, ‘AFRİKA’DAN GELEN BÜTÜN UÇAKLARI DURDURUN!!’ diyen Donald Trump gibi mi olacak? Yoksa Dr. Aybike Onur’un söylediklerine kulak verip, kendimizi d…
Ebola yayılmaya devam ediyor ve tüm dünya koordineli bir şekilde bu hastalığı tespit ve tecrit etmeye, onu küresel bir salgına dönüşmeden durdurmaya çalışıyor. Liberya’da ölmekte olan bir Ebola hastasını hastaneye götürürken virüs bulaştığı tahmin edilen, sağlıklı bir şekilde Amerika’ya geldikten sonra hastalık belirtileri göstermesi üzerine 28 Eyl…
Özellikle Gine, Liberya ve Sierra Leon olmak üzere Batı Afrika’yı Şubat ayından beri kasıp kavuran Ebola salgını bu hafta Amerika’da ilk vakanın teşhisiyle tekrar gündeme geldi. 20 Eylül’de hastalık belirtisi olmadan Liberya’dan uçak yoluyla Amerika’ya varan Liberyalı Thomas Eric Duncan, 24 Eylül itibariyle hastalık emareleri göstermeye başladı. 25…
ESMİYOR Bilim Kazanı’nda bu hafta New York’a gidiyoruz ve Birleşmiş Milletler’de 23 Eylül 2014’de gerçekleşen İklim Zirvesi öncesinde dünyanın her yanından çevre gönüllüleri ve aktivistlerin düzenlediği 20-21 Eylül İklim Adaleti yürüyüş ve etkinliklerinden bildiriyoruz. Konumuz artık geri dönüşü olmayan küresel ısınma ve İklim Değişikliği; konuğumu…
Geçtiğimiz hafta Açık Radyo’da Güneş Tanrısı Ra‘ya tapınmaya başladık! Siz de eşi eşeği kapın, etsiz ciğköftelerinizi alın, iklim değişikliği ve yenilebilir enerjiler hakkında yaptığımız bu ilk bölümü Güneş Mabedi’nin en on sırasından pürdikkat dinlemeye alın. Konuğumuz Orta Doğu Teknik Üniversitesi’nden mancınık ile Amerika’yi fethe gelen, önce Bo…
Bu hafta Türkiye’nin doğa bilimlerinden teknolojiye en popili popüler bilim sitesi Evrim Ağacı ile Türkiye’nin en lakayt ‘bilimciden al haberi’ popüler bilim radyo programı Bilim Kazanı olarak güçlerimizi birleştirdik. Konuğumuz Evrim Ağacı’nın kurucusu, ODTÜ Makine ve yan daldan Biyoloji mezunu, hakkını katmer katmer veren bir evrimsel biyoloji ok…
Meydan okuyanlar, meydan okunanlar, ciddiye alanlar, almayanlar, bu hastalıkla yaşayıp artık yalnız başına boğuşmadığı için bir nebze rahatlayanlar, boykotçular, bağışçılar, su tasarrufçuları, sosyal medya ilgi arsızları, futbol yorumcuları, kampanyayı amacından saptıranlar, kötü araçları amacın yerine koyup yargısız infaz yapanlar… #ALS #icebucket…
Bu hafta moleküler biyolojinin en temel öğretilerinden ‘merkezi dogma’yı sorguluyoruz. Bizi yoldan çıkaran ve kazana yasak elmayı yuvarlayan, Harvard Üniversitesi Moleküler ve Hücresel Biyoloji bölümünde doktora öğrenimine devam eden ve Firre (Ateşş) genetik dizilimi üzerinde çalışmalarını sürdüren Ezgi Hacısüleyman. Son 50 yıldır her biyoloji öğre…
Bilimi Lokman Hekim hikayelerinden öğrendik, yanıldık. Ölümsüzlüğün formülünü çiçekler fısıldamıyor, bu yolda kırlar ve ırmaklar yok. Bu yolda ter, gözyaşı, entrika, bazen de kan var! 5 Ağustos 2014’te bilim dünyası, dünyaca ünlü kök hücre biyoloğu Yoshiki Sasai’nin intiharı ile sarsıldı. Sasai’nin öğrencilerinden biri, kısa bir süre önce kök hücre…
Bu hafta bilim kardeşimiz, bibişimiz Bilim-Bilmiyim‘le el ele verdik ve yüce milletimize musallat olmuş Yoğurt Lobisi’nin (YoLo) köküne kibrit suyu ektik!! Teşekkürler bilimsiz bilim haberciliği, yaşasın ‘kolay-çözümlere-hop-dedi-atlamacılık’ ve hurra ‘yoğurt-ye-zehrini-alır-pazarlama’. Olmasaydınız olmazdık. Konumuz Milliyet gazetesi bilim dış hab…
Bilim Kazanı Unplugged Doktorlar kervanına geçtiğimiz haftalarda katılan, ekibimizin kurucu üyelerinden HİV/AİDS uzmanı virolog Dr. Öztop bu bölümde yurtdışında doktora yapma sürecini ve araştırmalarını anlattı. Gelin Boğaziçi Üniversitesi’nin Harvard Tıp Fakültesi’ne yolladığı Truva Atı İlker ile kah hüzün, kah gözyaşı, kah coşku ve eğlence dolu b…
Bu hafta beyne yolculuk yaparak algının kapılarını tamamen kırdık! Glioblastoma beyin tümörlerini tarihe gömmek üzere yola koyulan, Koç Üniversitesi’nin jet transferi Dr. Splinter Tuğba Bağcı-Önder’le bilimsel çetelesini, İstanbul’da kurduğu yeni laboratuvarını ve Türkiye’deki akademik hayatı konuştuk. Kanser hücrelerini canından bezdirip kendi ken…
Aşağıdakilerden hangisi Doğa’nın hakimidir? A) Ayı B) Dev Mürekkep Balığı C) İnsan D) Drogon E) Doğa’nın tek hakimi Doğa’dır cnms Aşağıdaki canlılardan hangisi şu koskoca alemde yalnızdır? A) Bülbül B) İlker C) Dev Kaplumbağa Yalnız George D) Ümit Besen E) Hiç bir canlı yalnız değildir. İster makro ister mikro düzeyde olsun, her canlı mutlaka diğer…
gatgcgctagcatcgatagcatcaagagctcgatcagctagcatacagcta gatgcgatagcatcgatagcatcaagagctcgatcagctagcatccagcta gatgcgctagcatcgatcgcatcaagagctcgatcagctagcatacagcta gatgcgctagcatcgatagcatcaagagctcgatcagctagcatgcagcta gatgcgatagcatcgatagcatcaagagctcgatcagctagcatacagcta İ – Aysu, ağzımdan bakteri topladım, bak. A – Aferim. İ – Ya bak bi, hepsini sekansladım, …
Woods Hole otobüsünün çamurlu tekerleri limanı boydan boya çizerken Aysu bu uzun yolculuğun sabahına uyandı; gün doğmuştu ve saatlerdir yolda olmalıydılar. Denizden seken güneş ışığı İlker’in boş koltuğunun yırtık döşemelerine vuruyordu, Aysu doğruldu ve herifçioğlunun kendini çoktan dışarı attığını gördü. İlker çiğnediği tütün parçasını yere tükür…
İlker koşar adımlarla Açık Radyo binasına girdi, Ömer Madra’nın hologramını geçip bir hışım kayıt odasının kapısını açıverdi. İçeride Aysu ve Alp, kayda henüz yeni başlıyorlardı. ”Kusura bakmayın geciktim, Jedi Tapınağında çok önemli bir toplantı vardı bugün, zaten Yoda yine pasif agresif, moralim çok bozuldu. Şimdi de kızla buluşmaya gideceğim, ka…
Solucanlardan farelere hayvanlar aleminde gözlemlenen en ilginç fenomenlerden biri günlük yenen besin miktarının yaklaşık %30 azaltılmasıyla ömrün önemli derecede uzaması ve sağlık değerlerinin yükselmesi. Biz de üzerimize düşeni yaptık ve bu çılgın teorinin insanlarda da geçerli olup olmadığını hem Sabancı, hem de Bilkent Üniversitesi’nin tozunu y…
Açık Radyo’da 8 Mayıs 2014 tarihinde Boğaziçi’nden olma, Harvard’dan doğma Dr. Deniz Ertürk’ü konuk ettiğimiz programın kaydıyla, size mikroplar hakkında tüm bildiklerinizi yeniden gözden geçirtmeye geliyoruz! Daha doğar doğmaz halleştiğimiz mikroplar, bizim sağlığımız için rakiplerine geçit vermeyen iyi mikropcanlar, fırsatçı ve tehlikeli ama aslı…
Sevgili Kazanistalar! Kısa süre önce müjdesini verdiğimiz gibi artık her Perşembe 14:00’da Açık Radyo‘dayız. Radyo programlarımızın kayıtlarını ucundan gecikmeli olarak bu adreste podcast olarak yayınlamaya devam edeceğiz. 11. Bölüm, 1 Mayıs 2014 Açık Radyo programımız. Radyoda ilk programımız olduğu için biraz kendimizi, doktora çalışmalarımızı ve…
Açık Radyo bizimle ciddi düşündü. Dünya evine giriyoruz, Açık Radyolu oluyoruz! Bizim çocuklar geçtiğimiz aylardaki flörtleşme döneminden sonra meğer işi ciddiye bindirmiş. Baktık başka oluru yok, haftasonu müstakbel kaynımız Ömer Madra ve şurekasını lokantamıza davet ettik. Allah’ın emri, peygamberin kavliyle Bilim Kazanı’nı Açık Radyo’ya istedile…
Bu hafta tetrapodların (bizim gibi 4 bacaklı hayvanların) evrimsel tarihinin tozlu sayfalarında dolaşıyoruz. 10 sene önce Kanada’nın arktik bölgesinde keşfedilen ve paleontoloji camiasını titreten 400 milyon yıllık fosil Tiktaalik’i konuşuyoruz. Hayvanların sudan karaya geçişinde ve karayı istila edişinde kilit bir dönemi temsil eden Tiktaalik fosi…
Gezegenimizden binlerce ışık yılı uzakta bilinmeyen bir cisim etrafındaki bütün enerjiyi merkezine doğru büyük bir kuvvetle çekiyordu. ‘Olay ufkuna yaklaşıyoruz’, dedi İlker. Bu çizgiyi geçtikleri anda ışığın bile kaçamadığı bir çekim kuvvetine tabi olacaklardı. Kaptan Bülent kontrol panelinin önündeki yerini aldı, ‘Yapabileceğimiz birşeyler olmalı…
Ilya Piskovic tıp fakültesine henüz o sonbahar başlamıştı. Haftalık yövmiyesi ancak yol parasını karşıladığı için annesinden yadigar piyanosunu tam 200 rubleye satmış, postallarının uzun kışa dayanamayacağından korktuğu için de okulun hemen yakınında çok da matah olmayan ve sıvaları dökülen bir ev tutmuştu. Ilya’nın bütün bu hazırlıkları yapmasına …
Dedektif Aysu omuzlarını silkti, döpiyesini dikkatlice asmış olduğu sandalyeyi kendine doğru çekti. “Teşkilatın yeniyıl kutlamasına tam 20 dakika var ve bunu kaçırmayı asla istemem. Yan odadaki ödlek arkadaşın ötmeden bu meseleyi burada halledelim, ha? Sen de, ben de biliyoruz; suçu itiraf et ve bu akşam karına güzel bir buket yaptırıp evine dön”. …
Kuantum fiziğinin sır perdesi, Harvard Üniversitesi Fizik departmanından jet transferimiz Alp Sipahigil ile aralanıyor! Newton’un borusunun ötmediği galaksilerden atom altı parçacıklara, çift yarık deneyinden çakma elmas döner sermayesine, bilgisayar dünyasındaki fetret devrinden Kanarya adalarındaki foton TELEPORTASYON deneylerine, Alp sayesinde e…
Tabular yıkılıyor, ayıplar bozuluyor! Bilim Kazanı Türk aile yapısını muhafaza etmeye yönelik yasaları hiçe sayarak bu bölüm KADIN, ERKEK ve SEKSİN EVRİMİNİ konuşuyor! Virüslerden insanlara kadar canlı-cansız herkes neden seks yapıyor? Alis’in Harikalar Diyarı’nda neler oluyor? Bağışıklık sistemi neden sekse muhtaç? Peki seksen milyon yıldır sekse …
Nasıl insan olduk? Biz sorduk, Harvard’da popülasyon genetiği ve evrim alanlarında çalışan Dr. Ömer Gökçümen yanıtladı! Neandertal kuzenlerimizden, ter bezlerimize… Koca kafalılığımızdan, amilaz enzimlerine… Eski matematik olimpiyatçısı İlker’in dev hesap hatasından, Türk erkeklerinin İtalyan erkeklerine olan yakın akrabalığına… yine egonuzu okşaya…
‘Neden kilo alıyoruz?’ dedi Aysu. Dr. Kıvanç omuzlarını silkti, ‘Doğru soru..’ dedi ve doğruldu, ‘Doğru soru şu, neden kilo almıyoruz?’. Uzaktan İlker’in kesif ve hüzünlü kahkahası duyuluyordu. Mayaladığı lokma hamuru tutmamıştı. Kilo almanın ve vermenin metabolizması, şişmanlığın nedenleri, yağ dokusunun evrimi, obezite ile gelen diğer hastalıklar…
Loading …

Hızlı referans rehberi

Google login Twitter login Classic login